Stem-loop sequence mmu-mir-592

AccessionMI0004127 (change log)
Symbol MGI:Mir592
DescriptionMus musculus miR-592 stem-loop
Gene family MIPF0000340; mir-592
Literature search

6 open access papers mention mmu-mir-592
(20 sentences)

Stem-loop
   u   --a     c     ca        a    c        gu    a 
5'  gau   uuaug cauga  uuguguca uaug gaugaugu  ugug u
    |||   ||||| |||||  |||||||| |||| ||||||||  ||||  
3'  cua   aaugc guacu  aacgcagu gugc cuacugcg  acac g
   a   cag     a     ac        g    a        --    g 
Get sequence
Deep sequencing
2596 reads, 13.7 reads per million, 51 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr6: 27936655-27936750 [-]
sense
OTTMUST00000050462 ; Grm8-002; intron 2
OTTMUST00000050461 ; Grm8-001; intron 3
OTTMUST00000050463 ; Grm8-003; intron 3
OTTMUST00000050464 ; Grm8-004; exon 6
ENSMUST00000090512 ; Grm8-002; intron 2
ENSMUST00000115324 ; Grm8-201; intron 2
ENSMUST00000115323 ; Grm8-001; intron 3
ENSMUST00000131897 ; Grm8-003; intron 3
ENSMUST00000146727 ; Grm8-004; exon 6
Database links

Mature sequence mmu-miR-592-5p

Accession MIMAT0003730
Previous IDsmmu-miR-592
Sequence

18 - 

auugugucaauaugcgaugaugu

 - 40

Get sequence
Deep sequencing2538 reads, 47 experiments
Evidence experimental; MPSS [1], Illumina [2]
Database links
Predicted targets

Mature sequence mmu-miR-592-3p

Accession MIMAT0017234
Previous IDsmmu-miR-592*
Sequence

58 - 

ucaucacguggugacgcaacau

 - 79

Get sequence
Deep sequencing46 reads, 18 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).