Stem-loop sequence mmu-mir-1934

AccessionMI0009923 (change log)
Symbol MGI:Mir1934
DescriptionMus musculus miR-1934 stem-loop
Literature search

1 open access papers mention mmu-mir-1934
(1 sentences)

Stem-loop
   --       u    u ug     -   cu         gucca 
5'   cugggcc ucuu c  guccc cug  ucguccucu     g
     ||||||| |||| |  ||||| |||  |||||||||      
3'   gacucgg agag g  cgggg ggc  aguaggaga     a
   gc       u    u gu     u   --         auugu 
Get sequence
Deep sequencing
58848 reads, 166 reads per million, 101 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 69663043-69663125 [+]
intergenic
Database links

Mature sequence mmu-miR-1934-5p

Accession MIMAT0009398
Previous IDsmmu-miR-1934
Sequence

13 - 

ucugguccccugcuucguccucu

 - 35

Get sequence
Deep sequencing493 reads, 66 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

Mature sequence mmu-miR-1934-3p

Accession MIMAT0017341
Previous IDsmmu-miR-1934*
Sequence

50 - 

aggaugacgguggggcugguga

 - 71

Get sequence
Deep sequencing6614 reads, 82 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).
2
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).