Stem-loop sequence tgu-mir-338

AccessionMI0013756 (change log)
DescriptionTaeniopygia guttata miR-338 stem-loop
Gene family MIPF0000097; mir-338
Stem-loop
   --------       cu   -         uca    aagu 
5'         agcaaca  auc cugaugcug   gagu    g
           |||||||  ||| |||||||||   ||||     
3'         uuguugu  uag gacuacgac   cucg    g
   aaugguga       uu   u         ---    aaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr14: 14972005-14972076 [-]
sense
ENSTGUT00000009014 ; BRI3-201; intron 1
ENSTGUT00000009086 ; LMTK2-201; intron 7
Database links

Mature sequence tgu-miR-338-5p

Accession MIMAT0017389
Sequence

4 - 

aacacuauccugaugcuguca

 - 24

Get sequence
Evidence experimental; Illumina [2]

Mature sequence tgu-miR-338-3p

Accession MIMAT0014542
Previous IDstgu-miR-338
Sequence

41 - 

uccagcaucagugauuuuguug

 - 62

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).