Stem-loop sequence aly-MIR164c

AccessionMI0014529 (change log)
DescriptionArabidopsis lyrata miR164c stem-loop
Gene family MIPF0000045; MIR164
Stem-loop
      u   ua    u  a     a  c              caca    a    g    g 
5' ggg gag  acac ug uggag ag agggcacgugcgaa    aaug gauc aucg u
   ||| |||  |||| || ||||| || ||||||||||||||    |||| |||| |||| a
3' ccc cuc  ugug ac accuc uc ucuugugcacgcuu    uuau cuag uagu c
      -   uc    c  a     c  a              ----    a    -    a 
Get sequence
Deep sequencing
175 reads, 5.3e+03 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348718.1: 12607212-12607326 [-]
intergenic
Database links

Mature sequence aly-miR164c-5p

Accession MIMAT0017453
Previous IDsaly-miR164c
Sequence

18 - 

uggagaagcagggcacgugcg

 - 38

Get sequence
Deep sequencing165 reads, 1 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence aly-miR164c-3p

Accession MIMAT0017454
Previous IDsaly-miR164c*
Sequence

81 - 

cacguguucuacuccuccaac

 - 101

Get sequence
Deep sequencing10 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).