Stem-loop sequence aly-MIR167d

AccessionMI0014542 (change log)
DescriptionArabidopsis lyrata miR167d stem-loop
Gene family MIPF0000023; MIR167_1
Stem-loop
   gaucuauaucua  c    -u     a            c  c           a      ca  cg                uaguuaauuuccacaccuauaaaaguuuuuuuccuacaacuuaaagcuuuuuuccuuccucuuuuuaauaauuagugaucuc 
5'             ug uggu  uuuag ggcugaagcugc ag augaucuggua uugcua  ua  acauacacacauauac                                                                                  u
               || ||||  ||||| |||||||||||| || ||||||||||| ||||||  ||  ||||||||||||||||                                                                                  a
3'             ac acca  aaauc cugacuucgacg uc uacuggaucau gaugau  au  uguguguguguaugug                                                                                  g
   --cuaaacuaua  a    cu     a            -  c           -      ag  -a                uuuuacguacguacauuugauacauauauauauguguguacguacuuagguggcauuuauauauaauguucauccguuucuu 
Get sequence
Deep sequencing
3690 reads, 1.26e+05 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348713.1: 16567499-16567825 [-]
intergenic
Database links

Mature sequence aly-miR167d-5p

Accession MIMAT0017479
Previous IDsaly-miR167d
Sequence

30 - 

ugaagcugccagcaugaucugg

 - 51

Get sequence
Deep sequencing3689 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

Mature sequence aly-miR167d-3p

Accession MIMAT0017480
Previous IDsaly-miR167d*
Sequence

281 - 

aggucauccugcagcuucagu

 - 301

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2