Stem-loop sequence aly-MIR398c

AccessionMI0014587 (change log)
DescriptionArabidopsis lyrata miR398c stem-loop
Gene family MIPF0000107; MIR398
Stem-loop
        ---u   u    a     uc   a    --         gc    aac  c     --        
5' gguag    gga cucg caggg  gac ugag  aacauauga  aauc   gg uguaa  augacgc 
   |||||    ||| |||| |||||  ||| ||||  |||||||||  ||||   || |||||  |||||| u
3' ccauc    ucu gagu guccc  cug acuc  uuguguacu  uugg   uc acauu  uacugca 
        ucuu   c    c     ca   g    aa         --    cuc  u     au        
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348718.1: 5880311-5880442 [+]
intergenic
Clustered miRNAs
< 10kb from aly-MIR398c
aly-MIR398bGL348718.1: 5876498-5876639 [+]
aly-MIR398cGL348718.1: 5880311-5880442 [+]
Database links

Mature sequence aly-miR398c-5p

Accession MIMAT0017569
Previous IDsaly-miR398c*
Sequence

18 - 

gggucgacaugagaacauaug

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aly-miR398c-3p

Accession MIMAT0017570
Previous IDsaly-miR398c
Sequence

92 - 

uguguuaacucaggucaccccug

 - 114

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).