Stem-loop sequence aly-MIR823

AccessionMI0014602 (change log)
DescriptionArabidopsis lyrata miR823 stem-loop
Gene family MIPF0001135; MIR823
Stem-loop
   -------g   a   c        agu  aaaau             ----    -a        c     c    uc aauc  g                     au     g    a  guauaua     --------uc             uacggaggcucauagcaaccc 
5'         gag aag uuuuuuua   ga     uucagggaugcua    aucc  auagaugg ggaua guuu  c    ac aaucuuguaugaucacuaacc  uggaa uaaa ga       ugacu          gaacgguuugcaa                     u
           ||| ||| ||||||||   ||     |||||||||||||    ||||  |||||||| ||||| ||||  |    || |||||||||||||||||||||  ||||| |||| ||       |||||          |||||||||||||                      
3'         uuu uuc aagagagu   cu     aagucccugugau    uagg  uaucuacc ccuau caaa  g    ug uuaggauauacuagugguugg  aucuu auuu cu       acuga          cuugccgaacguu                     u
   uuucugug   g   c        --g  --gau             uaau    gc        c     a    gu acaa  g                     --     g    a  -------     uaaaauuaaa             caacguuauaaucguucuucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348715.1: 5608850-5609174 [-]
intergenic
Database links

Mature sequence aly-miR823-5p

Accession MIMAT0017601
Previous IDsaly-miR823*
Sequence

78 - 

cuuguaugaucacuaaccau

 - 97

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aly-miR823-3p

Accession MIMAT0017602
Previous IDsaly-miR823
Sequence

221 - 

uagguuggugaucauauaggau

 - 242

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).