Stem-loop sequence aly-MIR857

AccessionMI0014623 (change log)
DescriptionArabidopsis lyrata miR857 stem-loop
Gene family MIPF0001180; MIR857
Stem-loop
       -   uu   --------aaua       c g      caa       c             ca     -----aac       a   --- ug     g   g              cg   u   gaa  au      --aa           uug     c             --u      u  ug      a   uuuu      uauc   augagaccucagguaacaagguaaaagag 
5' cuca aaa  ucu            uuuucga u cuacaa   acuuuca cauacaaaauaau  agaaa        acucaaa aga   u  aaugu uga guuagucucauuaa  gaa ugu   ca  uuuguu    aaaauagugac   guuuu aaauguauuuuuu   aaagaa aa  uuuuuu gcu    auuaua    aac                             a
   |||| |||  |||            ||||||| | ||||||   ||||||| |||||||||||||  |||||        ||||||| |||   |  ||||| ||| ||||||||||||||  ||| |||   ||  ||||||    |||||||||||   ||||| |||||||||||||   |||||| ||  |||||| |||    ||||||    |||                              
3' gagu uuu  aga            aaaggcu a gauguu   uggaagu guauguuuuauug  ucuuu        ugaguuu ucu   g  uuacg gcu uaauuagaguaauu  cuu aca   gu  aaacgg    uuuuaucacug   caaaa uuuauauaaaaag   uuuuuu uu  gaagaa uga    ugauau    uug                             c
       a   uu   acucucaacuac       a g      aug       u             aa     guuuuuca       a   uua gu     a   g              au   u   --g  --      caaa           uga     u             uuu      u  uu      a   uauu      ----   aacuuuuuuaauuuaaaaaaauaaaaaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348719.1: 14977807-14978279 [-]
intergenic
Clustered miRNAs
< 10kb from aly-MIR857
aly-MIR397bGL348719.1: 14978335-14978465 [-]
aly-MIR857GL348719.1: 14977807-14978279 [-]
Database links

Mature sequence aly-miR857-5p

Accession MIMAT0017643
Previous IDsaly-miR857*
Sequence

34 - 

aaacuuucaccauacaaaaua

 - 54

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aly-miR857-3p

Accession MIMAT0017644
Previous IDsaly-miR857
Sequence

413 - 

uuuuguauguugaagguguau

 - 433

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).