Stem-loop sequence aly-MIR869

AccessionMI0014648 (change log)
DescriptionArabidopsis lyrata miR869 stem-loop
Gene family MIPF0001167; MIR869
Stem-loop
      u            ga   c     a   a     a  a   c         c     ug            c      ca   uaa     cc        c     c        u         -  accuuauauugucccuuguu 
5' gua gcucaccacaca  uuu cauac gua aagaa gu uca uuaucucaa ccuag  auuggaccagua ugugcu  uca   uugag  auaauuca gauuc ucaucaga acaaaguca ca                    u
   ||| ||||||||||||  ||| ||||| ||| ||||| || ||| ||||||||| |||||  |||||||||||| ||||||  |||   |||||  |||||||| ||||| |||||||| ||||||||| ||                     
3' cau cggguggugugu  aaa guaug cau uucuu ca agu aauagaguu ggguc  uaacuugguugu acacga  agu   aauuc  uguuaggu uuagg aguagucu uguuucggu gu                    c
      u            ac   a     c   a     -  c   u         u     cu            u      ag   cac     uu        u     a        u         a  auuagacacucuaaccaaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348719.1: 23046984-23047287 [+]
intergenic
Database links

Mature sequence aly-miR869-5p

Accession MIMAT0017695
Previous IDsaly-miR869*
Sequence

43 - 

cacuuaucucaacccuaguga

 - 63

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aly-miR869-3p

Accession MIMAT0017696
Previous IDsaly-miR869
Sequence

245 - 

ccuggguuugagauaauugac

 - 265

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).