Stem-loop sequence aly-MIR3446

AccessionMI0014662 (change log)
DescriptionArabidopsis lyrata miR3446 stem-loop
Stem-loop
       u   gu     a         g   g         aaac      ucg    a   u          u      u   -uac            c u         a   u     aagggaaaccgugauuaguaugacauc 
5' cucc auc  ccaau guuuuuuug aaa gcuucauuu    agagag   uuuu ucc gggaacucac ccaucg gaa    ucggaagcuaga g guggcaggg aaa gaguu                           g
   |||| |||  ||||| ||||||||| ||| |||||||||    ||||||   |||| ||| |||||||||| |||||| |||    |||||||||||| | ||||||||| ||| |||||                            
3' gagg uag  gguua caaagaagc uuu cgaaguagg    ucuuuc   aaaa agg uccuugagug gguagc uuu    agccuucgauuu c caccguccc uuu cucaa                           c
       -   --     a         a   g         cauc      uaa    g   u          -      u   ucua            u u         c   c     auucuagaaacacuuacgacggccaac 
Get sequence
Deep sequencing
3 reads, 100 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348714.1: 16331891-16332181 [-]
intergenic
Database links

Mature sequence aly-miR3446-5p

Accession MIMAT0017727
Previous IDsaly-miR3446
Sequence

85 - 

cucggaagcuagacguguggcagg

 - 108

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR3446-3p

Accession MIMAT0017728
Previous IDsaly-miR3446*
Sequence

189 - 

ugccacucuuuuagcuuccgaauc

 - 212

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2