Stem-loop sequence esi-MIR3464

AccessionMI0014670 (change log)
DescriptionEctocarpus siliculosus miR3464 stem-loop
Stem-loop
               g                             g                   c      gggaa 
5' agaccccucgac gucggaguauggguugcgauggaaucaug uagauaaacaugcagacga guccag     u
   |||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||     a
3' ucuggggagcug cagccucauacccaacgcuaccuuaguac aucuauuuguacgucugcu cagguc     u
               g                             a                   a      aaaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EctsiV2) Overlapping transcripts
sctg_57: 505465-505615 [+]
intergenic
Database links

Mature sequence esi-miR3464-5p

Accession MIMAT0017743
Previous IDsesi-miR3464
Sequence

15 - 

ucggaguauggguugcgaugg

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence esi-miR3464-3p

Accession MIMAT0017744
Previous IDsesi-miR3464*
Sequence

120 - 

ucgcaacccauacuccgacgg

 - 140

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20520714 "The Ectocarpus genome and the independent evolution of multicellularity in brown algae" Cock JM, Sterck L, Rouze P, Scornet D, Allen AE, Amoutzias G, Anthouard V, Artiguenave F, Aury JM, Badger JH, Beszteri B, Billiau K, Bonnet E, Bothwell JH, Bowler C, Boyen C, Brownlee C, Carrano CJ, Charrier B, Cho GY, Coelho SM, Collen J, Corre E, Da Sil Nature. 465:617-621(2010).