Stem-loop sequence esi-MIR3459

AccessionMI0014686 (change log)
DescriptionEctocarpus siliculosus miR3459 stem-loop
Stem-loop
   -       c         c    uug             c   c  gc  uc      
5'  ggucugu cggaggucc cuug   cuugaaugcaagc aag ug  uc  cgaua 
    ||||||| ||||||||| ||||   ||||||||||||| ||| ||  ||  |||| g
3'  ccagacg gccuccagg gaac   gaacuugcguucg uuc au  ag  gcugc 
   c       c         c    caa             c   u  -a  ca      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EctsiV2) Overlapping transcripts
sctg_270: 210232-210344 [-]
intergenic
Database links

Mature sequence esi-miR3459-5p

Accession MIMAT0017775
Previous IDsesi-miR3459*
Sequence

7 - 

uccggagguccccuuguugcuu

 - 28

Get sequence
Evidence experimental; Illumina [1]

Mature sequence esi-miR3459-3p

Accession MIMAT0017776
Previous IDsesi-miR3459
Sequence

82 - 

uucaagaaccaagcggaccuc

 - 102

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20520714 "The Ectocarpus genome and the independent evolution of multicellularity in brown algae" Cock JM, Sterck L, Rouze P, Scornet D, Allen AE, Amoutzias G, Anthouard V, Artiguenave F, Aury JM, Badger JH, Beszteri B, Billiau K, Bonnet E, Bothwell JH, Bowler C, Boyen C, Brownlee C, Carrano CJ, Charrier B, Cho GY, Coelho SM, Collen J, Corre E, Da Sil Nature. 465:617-621(2010).