Stem-loop sequence pab-MIR3706

AccessionMI0016108 (change log)
DescriptionPicea abies miR3706 stem-loop
Stem-loop
   -    augaca   a    g   gg       -----------       gu 
5'  gcaa      guu uauu cau  uuucgga           ggaaugg  a
    ||||      ||| |||| |||  |||||||           |||||||   
3'  cguu      cag auag gua  gaggcuu           ucuuacc  a
   g    ----aa   a    -   ag       ugguacguuac       ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MA_133151: 7144-7232 [-]
intergenic
Database links

Mature sequence pab-miR3706

Accession MIMAT0018138
Sequence

62 - 

uuucggaggaauggauaaga

 - 81

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:20561211 "MicroRNAs, the epigenetic memory and climatic adaptation in Norway spruce" Yakovlev IA, Fossdal CG, Johnsen O New Phytol. 187:1154-1169(2010).