Stem-loop sequence gma-MIR4359b

AccessionMI0016494 (change log)
DescriptionGlycine max miR4359b stem-loop
Gene family MIPF0001181; MIR4359
Stem-loop
          c    g                   c 
5' auguuaa gcgu auauguuaacaucgguuuu c
   ||||||| |||| |||||||||||||||||||  
3' uacaauu cgua ugugcaauuguagcuaaaa a
          a    -                   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr7: 16796162-16796228 [+]
intergenic
Database links

Mature sequence gma-miR4359b

Accession MIMAT0018253
Sequence

6 - 

aacgcgugauauguuaacaucggu

 - 29

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).