Stem-loop sequence gma-MIR4387c

AccessionMI0016495 (change log)
DescriptionGlycine max miR4387c stem-loop
Gene family MIPF0001109; MIR4387
Literature search

1 open access papers mention gma-MIR4387c
(1 sentences)

Stem-loop
         a           c  u                     cuugugguggacauaucaucac 
5' cauuaa ugaugauguga ag uggagugucacgucaucacgc                      c
   |||||| ||||||||||| || |||||||||||||||||||||                       
3' guaauu acuacugcacu uc gccucacagugcaguagugcg                      u
         c           a  u                     aauuagugauugugcaguaauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr7: 16521619-16521750 [+]
intergenic
Database links

Mature sequence gma-miR4387c

Accession MIMAT0018254
Sequence

89 - 

agcgugaugacgugacacuccguc

 - 112

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).