Stem-loop sequence nlo-mir-281

AccessionMI0016656 (change log)
DescriptionNasonia longicornis miR-281 stem-loop
Gene family MIPF0000087; mir-46
Stem-loop
   cg             -ua     c      a g  g 
5'   cuauaaagagagc   uccau gacagu u gu a
     |||||||||||||   ||||| |||||| | || u
3'   gguguuucucucg   aggua cuguca a ua a
   ca             uuc     -      c g  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nlo-miR-281

Accession MIMAT0018415
Sequence

47 - 

ugucauggacuugcucucuuug

 - 68

Get sequence
Evidence not experimental

References

1
"Computational Identification and Characterization of Putative miRNAs in Nasonia Species" Sathyamurthy G, Swamy NR Int J Insect Sci. 2:1-13(2010).