Stem-loop sequence nlo-mir-305

AccessionMI0016673 (change log)
DescriptionNasonia longicornis miR-305 stem-loop
Gene family MIPF0000158; mir-305
Stem-loop
   gga   ---ug     u     ua     u    ug  cu    au 
5'    ggc     caugu aauug  cuuca cagg  cu  ggug  u
      |||     ||||| |||||  ||||| ||||  ||  ||||  u
3'    ccg     guaua uuaac  gaggu gucc  gg  ccau  u
   ---   uguua     c     gc     u    gu  -c    ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nlo-miR-305

Accession MIMAT0018432
Sequence

16 - 

auuguacuucaucaggugcucug

 - 38

Get sequence
Evidence not experimental

References

1
"Computational Identification and Characterization of Putative miRNAs in Nasonia Species" Sathyamurthy G, Swamy NR Int J Insect Sci. 2:1-13(2010).