Stem-loop sequence csi-MIR827

AccessionMI0016727 (change log)
DescriptionCitrus sinensis miR827 stem-loop
Gene family MIPF0001113; MIR827_3
Literature search

4 open access papers mention csi-MIR827
(5 sentences)

Stem-loop
   -------------------- c        u             --uu  uuu    uccu 
5'                     g uuguugau gucaucuaaucau    uc   uuca    a
                       | |||||||| |||||||||||||    ||   ||||     
3'                     c aacaacua caguagauuggua    ag   aagu    g
   cguacguuaugguacuuaua a        c             uauu  --u    uuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
JH999145.1: 323612-323711 [+]
intergenic
Database links

Mature sequence csi-miR827

Accession MIMAT0018485
Sequence

61 - 

uuagaugaccaucaacaaaca

 - 81

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).
2
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).