Stem-loop sequence ame-mir-3718a

AccessionMI0016150 (change log)
DescriptionApis mellifera miR-3718a stem-loop
Gene family MIPF0001225; mir-3718
Stem-loop
   u    -----        -----------------       a         au          uag      --------   a 
5'  ugaa     agucguuc                 ccgauuu cauuaucgg  caggauaggg   ggcagg        gcc u
    ||||     ||||||||                 ||||||| |||||||||  ||||||||||   ||||||        ||| u
3'  acuu     ucagcaag                 ggcuaag gugauagcc  guccuguccc   cugucu        ugg u
   u    auuug        uauuaaagcuaagucau       a         cu          ---      uaccaaua   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000059.5: 6820223-6820362 [-]
intergenic
Clustered miRNAs
< 10kb from ame-mir-3718a
ame-mir-3718cCM000059.5: 6820449-6820538 [-]
ame-mir-3718bCM000059.5: 6820246-6820356 [+]
ame-mir-3718aCM000059.5: 6820223-6820362 [-]
Database links

Mature sequence ame-miR-3718a-3p

Accession MIMAT0018520
Sequence

75 - 

uccccuguccugucccgauag

 - 95

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).