Stem-loop sequence ame-mir-3720

AccessionMI0016168 (change log)
DescriptionApis mellifera miR-3720 stem-loop
Stem-loop
   cu           --    -----    g    -aaca      ---acccg       uuu   uc  a     au 
5'   gagguucauac  ggug     auga uuua     guuuac        agucugg   cga  ga ccuca  u
     |||||||||||  ||||     |||| ||||     ||||||        |||||||   |||  || |||||   
3'   cuucaaguaug  ucgc     uacu agau     caaaug        uuagacc   gcu  cu ggggu  u
   --           ag    auuga    g    guuug      agaaagua       -uu   --  a     cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000059.5: 7680289-7680428 [+]
intergenic
Database links

Mature sequence ame-miR-3720-5p

Accession MIMAT0018538
Sequence

10 - 

auacggugaugaguuuaaacag

 - 31

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).