Stem-loop sequence ame-mir-3731

AccessionMI0016229 (change log)
DescriptionApis mellifera miR-3731 stem-loop
Stem-loop
   -  -   a  ag    aa    a    --------    a    -  aacu   g  u 
5'  gg uau gu  cuug  gaac ucga        ccaa gcuu gc    gau cc g
    || ||| ||  ||||  |||| ||||        |||| |||| ||    ||| ||  
3'  cu aug ua  gagc  cuug agcu        gguu cgaa cg    cua gg a
   g  g   a  ca    ac    a    uuccguuu    g    a  ----   a  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000058.5: 7042744-7042846 [+]
intergenic
Database links

Mature sequence ame-miR-3731-5p

Accession MIMAT0018599
Sequence

17 - 

gaacaucgaccaaagcuugcaac

 - 39

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).