Stem-loop sequence isc-mir-305

AccessionMI0016444 (change log)
DescriptionIxodes scapularis miR-305 stem-loop
Gene family MIPF0000158; mir-305
Literature search

1 open access papers mention isc-mir-305
(2 sentences)

Stem-loop
   -ca      a    a          uc      u    -a  u    
5'    gucacu guua uuguacuuca  aggugc cugg  gu cgg 
      |||||| |||| ||||||||||  |||||| ||||  || || u
3'    cgguga uagu aacgugaggu  ucuacg gacc  ca gcu 
   gca      a    a          uu      -    aa  c    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Iscaw1) Overlapping transcripts
DS945001: 228261-228350 [-]
intergenic
Database links

Mature sequence isc-miR-305

Accession MIMAT0018920
Sequence

14 - 

auuguacuucaucaggugcucu

 - 35

Get sequence
Evidence not experimental

References

1
PMID:20702459 "A congruent solution to arthropod phylogeny: phylogenomics, microRNAs and morphology support monophyletic Mandibulata" Rota-Stabelli O, Campbell L, Brinkmann H, Edgecombe GD, Longhorn SJ, Peterson KJ, Pisani D, Philippe H, Telford MJ Proc Biol Sci. 278:298-306(2011).