Stem-loop sequence rlcv-mir-rL1-11

AccessionMI0003747 (change log)
DescriptionRhesus lymphocryptovirus miR-rL1-11 stem-loop
Stem-loop
   -  g     -                a     g   uggc 
5'  gg gccuu gccuccguauccuauc agugu acg    u
    || ||||| |||||||||||||||| ||||| |||     
3'  cc cggaa ugggggcauaggauag ucaca ugc    u
   u  g     a                c     g   uugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rlcv-miR-rL1-11-5p

Accession MIMAT0019089
Previous IDsrlcv-mir-rL1-11-5p
Sequence

13 - 

ccguauccuaucaagugugacg

 - 34

Get sequence
Evidence experimental; Illumina [2-3]

Mature sequence rlcv-miR-rL1-11-3p

Accession MIMAT0003440
Previous IDsrlcv-miR-rL1-11
Sequence

47 - 

ugacacucgauaggauacgggg

 - 68

Get sequence
Evidence experimental; cloned [1], Illumina [2-3]

References

1
PMID:16557291 "Epstein-Barr virus microRNAs are evolutionarily conserved and differentially expressed" Cai X, Schafer A, Lu S, Bilello JP, Desrosiers RC, Edwards R, Raab-Traub N, Cullen BR PLoS Pathog. 2:e23(2006).
2
PMID:20219930 "Comprehensive analysis of Rhesus lymphocryptovirus microRNA expression" Riley KJ, Rabinowitz GS, Steitz JA J Virol. 84:5148-5157(2010).
3
PMID:24257599 "Evolutionary conservation of primate lymphocryptovirus microRNA targets" Skalsky RL, Kang D, Linnstaedt SD, Cullen BR J Virol. 88:1617-1635(2014).