Stem-loop sequence rlcv-mir-rL1-13

AccessionMI0003749 (change log)
DescriptionRhesus lymphocryptovirus miR-rL1-13 stem-loop
Gene family MIPF0000328; mir-BART7
Stem-loop
       -   c   a          g        aa     c 
5' cccg ugu uug uccugggcau ggcuauga  caguu u
   |||| ||| ||| |||||||||| ||||||||  ||||| a
3' gggc acg ggc gggaccugug ccgauacu  guuaa a
       c   u   a          a        ag     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rlcv-miR-rL1-13-5p

Accession MIMAT0019090
Previous IDsrlcv-mir-rL1-13-5p
Sequence

14 - 

ccugggcaugggcuaugaaaca

 - 35

Get sequence
Evidence experimental; Illumina [2-3]

Mature sequence rlcv-miR-rL1-13-3p

Accession MIMAT0003443
Previous IDsrlcv-miR-rL1-13
Sequence

49 - 

gaucauagccaguguccaggga

 - 70

Get sequence
Evidence experimental; cloned [1], Illumina [2-3]

References

1
PMID:16557291 "Epstein-Barr virus microRNAs are evolutionarily conserved and differentially expressed" Cai X, Schafer A, Lu S, Bilello JP, Desrosiers RC, Edwards R, Raab-Traub N, Cullen BR PLoS Pathog. 2:e23(2006).
2
PMID:20219930 "Comprehensive analysis of Rhesus lymphocryptovirus microRNA expression" Riley KJ, Rabinowitz GS, Steitz JA J Virol. 84:5148-5157(2010).
3
PMID:24257599 "Evolutionary conservation of primate lymphocryptovirus microRNA targets" Skalsky RL, Kang D, Linnstaedt SD, Cullen BR J Virol. 88:1617-1635(2014).