Stem-loop sequence rlcv-mir-rL1-18

AccessionMI0013277 (change log)
DescriptionRhesus lymphocryptovirus miR-rL1-18 stem-loop
Stem-loop
           g   u       u     c   guau      au 
5' aggugugg guu agaugau ggggg ggc    cuuuug  u
   |||||||| ||| ||||||| ||||| |||    ||||||   
3' uuuacacc cag ucuacua cccuc ccg    gaaaau  u
           a   u       c     c   -auu      gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rlcv-miR-rL1-18-5p

Accession MIMAT0019186
Previous IDsrlcv-mir-rL1-18-5p
Sequence

13 - 

uagaugauugggggcggcguauc

 - 35

Get sequence
Evidence experimental; Illumina [2-3]

Mature sequence rlcv-miR-rL1-18-3p

Accession MIMAT0016941
Previous IDsrlcv-miR-rL1-18
Sequence

53 - 

uuagccccuccccaucaucuug

 - 74

Get sequence
Evidence experimental; Northern [1], PCR [1], Illumina [2-3]

References

1
PMID:19889779 "A global analysis of evolutionary conservation among known and predicted gammaherpesvirus microRNAs" Walz N, Christalla T, Tessmer U, Grundhoff A J Virol. 84:716-728(2010).
2
PMID:20219930 "Comprehensive analysis of Rhesus lymphocryptovirus microRNA expression" Riley KJ, Rabinowitz GS, Steitz JA J Virol. 84:5148-5157(2010).
3
PMID:24257599 "Evolutionary conservation of primate lymphocryptovirus microRNA targets" Skalsky RL, Kang D, Linnstaedt SD, Cullen BR J Virol. 88:1617-1635(2014).