Stem-loop sequence pma-mir-92a

Accession

MI0017050 (change log)

Description

Petromyzon marinus miR-92a stem-loop

Gene family

MIPF0000013; mir-25

Stem-loop

   ccu   c          a       ca        u  c 
5'    guc cgcugagguc ggauggg  gcaaugcg ga u
      ||| |||||||||| |||||||  |||||||| || a
3'    uag gcgauuccgg ccugcuc  cguuaugu cu g
   auu   a          c       -a        c  a 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Petromyzon_marinus-7.0; GCA_000148955.1): GL478379.1: 407029-407108 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from pma-mir-92a

• pma-mir-17a: GL478379.1: 403379-403460 [+]
• pma-mir-18b: GL478379.1: 403671-403761 [+]
• pma-mir-17b: GL478379.1: 404297-404390 [+]
• pma-mir-19c: GL478379.1: 404996-405075 [+]
• pma-mir-20a: GL478379.1: 406609-406699 [+]
• pma-mir-19b: GL478379.1: 406814-406897 [+]
• pma-mir-92a: GL478379.1: 407029-407108 [+]
• pma-mir-25b: GL478379.1: 408922-409013 [+]

Database links

• miRBase Tracker:MI0017050

Mature sequence pma-miR-92a

• Accession: MIMAT0019435
• Sequence: 49 - uauugcacucgucccggccuua - 70
• Evidence: experimental; 454 [1]

References

1. PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).