Stem-loop sequence pma-mir-124

AccessionMI0017057 (change log)
DescriptionPetromyzon marinus miR-124 stem-loop
Gene family MIPF0000021; mir-124
Stem-loop
   cgu        c        a   ga        uaau 
5'    ccgcucuu guguucac gcg  ccuugauu    g
      |||||||| |||||||| |||  ||||||||    u
3'    ggcgagaa cguaagug cgc  ggaauuaa    g
   ugu        c        g   ac        cauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pma-miR-124-5p

Accession MIMAT0019444
Previous IDspma-miR-124*
Sequence

12 - 

cguguucacagcggaccuugau

 - 33

Get sequence
Evidence experimental; 454 [1]

Mature sequence pma-miR-124-3p

Accession MIMAT0019445
Previous IDspma-miR-124
Sequence

49 - 

uaaggcacgcggugaaugcca

 - 69

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).