Stem-loop sequence pma-mir-143

AccessionMI0017078 (change log)
DescriptionPetromyzon marinus miR-143 stem-loop
Gene family MIPF0000094; mir-143
Stem-loop
   uac      g            c   u gu ggg 
5'    ccgggg ugcagugcuuua cuc g  u   u
      |||||| |||||||||||| ||| |  |    
3'    ggccuc augucacgaagu gag c  a   u
   gua      a            a   u ug gag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pma-miR-143-5p

Accession MIMAT0019472
Previous IDspma-miR-143*
Sequence

9 - 

ggugcagugcuuuaccucugg

 - 29

Get sequence
Evidence experimental; 454 [1]

Mature sequence pma-miR-143-3p

Accession MIMAT0019473
Previous IDspma-miR-143
Sequence

44 - 

ugagaugaagcacuguaacucc

 - 65

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).