Stem-loop sequence pma-mir-281a

AccessionMI0017120 (change log)
DescriptionPetromyzon marinus miR-281a stem-loop
Stem-loop
   a cg  u u             uc g           gauuug 
5'  g  ac g cgagcaggggagc  c uccaugacggg      u
    |  || | |||||||||||||  | |||||||||||      c
3'  c  ug c gcucguucucucg  g agguacuguuc      g
   g au  c -             uu -           augugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Petromyzon_marinus-7.0; GCA_000148955.1) Overlapping transcripts
GL476811.1: 83187-83273 [-]
intergenic
Database links

Mature sequence pma-miR-281a

Accession MIMAT0019535
Sequence

55 - 

ugucauggaguugcucucuugc

 - 76

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).