Stem-loop sequence pma-mir-4581

AccessionMI0017191 (change log)
DescriptionPetromyzon marinus miR-4581 stem-loop
Stem-loop
   gug  ug a      a   aaag   g    ca  -  u  g 
5'    gc  c cgggcc ggu    cgu ccga  cg gc cg a
      ||  | |||||| |||    ||| ||||  || || ||  
3'    cg  g gcucgg ccg    gca ggcu  gc cg gc u
   uga  gu g      c   ----   a    -c  u  -  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Petromyzon_marinus-7.0; GCA_000148955.1) Overlapping transcripts
GL493616.1: 3649-3727 [+]
intergenic
Database links

Mature sequence pma-miR-4581

Accession MIMAT0019614
Sequence

51 - 

gcucggaacggcccggcucgggu

 - 73

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).