Stem-loop sequence pma-mir-4595

AccessionMI0017205 (change log)
DescriptionPetromyzon marinus miR-4595 stem-loop
Stem-loop
   ucc         cca       u u           aaaua 
5'    gcauggugu   guguuuc c ccacgugcugg     a
      |||||||||   ||||||| | |||||||||||     a
3'    cgugccgca   cguaaag g ggugcacgacc     u
   agu         cac       u u           cucgc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Petromyzon_marinus-7.0; GCA_000148955.1) Overlapping transcripts
GL479869.1: 111747-111831 [-]
intergenic
Database links

Mature sequence pma-miR-4595

Accession MIMAT0019628
Sequence

14 - 

caguguuucucuccacgugcugg

 - 36

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).