![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence pma-mir-4595 |
|||||
Accession | MI0017205 (change log) | ||||
Description | Petromyzon marinus miR-4595 stem-loop | ||||
Stem-loop |
ucc cca u u aaaua 5' gcauggugu guguuuc c ccacgugcugg a ||||||||| ||||||| | ||||||||||| a 3' cgugccgca cguaaag g ggugcacgacc u agu cac u u cucgc |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence pma-miR-4595 |
|
Accession | MIMAT0019628 |
Sequence |
14 - caguguuucucuccacgugcugg - 36 |
Evidence | experimental; 454 [1] |
References |
|
1 |
PMID:20959416
"microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate"
Proc Natl Acad Sci U S A. 107:19379-19383(2010).
|