Stem-loop sequence osa-MIR812o

AccessionMI0017255 (change log)
DescriptionOryza sativa miR812o stem-loop
Gene family MIPF0000345; MIR812
Literature search

9 open access papers mention osa-MIR812o
(15 sentences)

Stem-loop
              uc             c   c    a      uuuuuuuauuaguauuuuuauuauuguuagaugauaaaacaug 
5' gguuuucgugu  aacguuugacugu uau uuau ugaaaa                                           a
   |||||||||||  ||||||||||||| ||| |||| ||||||                                           a
3' ucaaaggcaca  uuguaaacuggca gua aaua auuuuu                                           u
              ga             a   a    a      uuaauacuuuuuuuaauuuuucuauucaguacguauuucauaa 
Get sequence
Deep sequencing
1172 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence osa-miR812o-5p

Accession MIMAT0019681
Sequence

7 - 

cguguucaacguuugacuguc

 - 27

Get sequence
Deep sequencing105 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence osa-miR812o-3p

Accession MIMAT0019682
Sequence

146 - 

gaacggucaaauguuagacacgga

 - 169

Get sequence
Deep sequencing823 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1