Stem-loop sequence cel-mir-4809

AccessionMI0017539 (change log)
DescriptionCaenorhabditis elegans miR-4809 stem-loop
Stem-loop
   -- u         -    a      uugau 
5'   g aaguucaga guug auuauc     c
     | ||||||||| |||| ||||||      
3'   c uucgggucu caac uaauag     a
   ga c         u    a      uuuau 
Get sequence
Deep sequencing
23 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 1873646-1873704 [+]
sense
Y59E1B.2 ; Y59E1B.2; intron 2
Clustered miRNAs
< 10kb from cel-mir-4809
cel-mir-4807chrX: 1872466-1872526 [+]
cel-mir-4808chrX: 1872952-1873008 [+]
cel-mir-4809chrX: 1873646-1873704 [+]
cel-mir-2220chrX: 1873827-1873884 [+]
cel-mir-4810bchrX: 1874016-1874075 [+]
cel-mir-4810achrX: 1875738-1875794 [+]
cel-mir-1018chrX: 1879458-1879513 [+]
cel-mir-4925chrX: 1879562-1879620 [+]
cel-mir-4923bchrX: 1879640-1879698 [+]
cel-mir-4923achrX: 1879876-1879936 [+]
cel-mir-4921chrX: 1879979-1880038 [+]
Database links

Mature sequence cel-miR-4809-5p

Accession MIMAT0019993
Previous IDscel-miR-4809*
Sequence

1 - 

guaaguucagaguugaauuauc

 - 22

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence cel-miR-4809-3p

Accession MIMAT0019994
Previous IDscel-miR-4809
Sequence

37 - 

uaauacaacuucugggcuuccag

 - 59

Get sequence
Deep sequencing23 reads, 9 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:21085120 "Formation, regulation and evolution of Caenorhabditis elegans 3'UTRs" Jan CH, Friedman RC, Ruby JG, Bartel DP Nature. 469:97-101(2011).
2
PMID:21177960 "Computational and experimental identification of mirtrons in Drosophila melanogaster and Caenorhabditis elegans" Chung WJ, Agius P, Westholm JO, Chen M, Okamura K, Robine N, Leslie CS, Lai EC Genome Res. 21:286-300(2011).