Stem-loop sequence cel-mir-4811

AccessionMI0017541 (change log)
DescriptionCaenorhabditis elegans miR-4811 stem-loop
Stem-loop
   aaa         u          cu      a   acauaca 
5'    auuguggua ugaacaauac  guguua aag       u
      ||||||||| ||||||||||  |||||| |||        
3'    ugacaucau gcuuguuaug  cacaau uuc       a
   ---         c          cu      a   cacgacg 
Get sequence
Deep sequencing
12 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 7185347-7185429 [-]
intergenic
Database links

Mature sequence cel-miR-4811-5p

Accession MIMAT0019996
Previous IDscel-miR-4811*
Sequence

14 - 

ugaacaauaccuguguuaaaag

 - 35

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence cel-miR-4811-3p

Accession MIMAT0019997
Previous IDscel-miR-4811
Sequence

54 - 

uauaacacucguauuguucgcu

 - 75

Get sequence
Deep sequencing11 reads, 7 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21085120 "Formation, regulation and evolution of Caenorhabditis elegans 3'UTRs" Jan CH, Friedman RC, Ruby JG, Bartel DP Nature. 469:97-101(2011).