Stem-loop sequence sko-mir-4818c

AccessionMI0017551 (change log)
DescriptionSaccoglossus kowalevskii miR-4818c stem-loop
Stem-loop
   caa  aaau   uu ug             gauu c        -    g 
5'    ga    cug  g  uggaacgccacug    g gcaauuag uuaa u
      ||    |||  |  |||||||||||||    | |||||||| ||||  
3'    cu    gac  c  aucuuguggugac    c cguuaauc aguu a
   --a  aucc   cu ua             auuu a        u    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Skow_1.1; GCA_000003605.1) Overlapping transcripts
GL015416.1: 65470-65568 [-]
intergenic
Clustered miRNAs
< 10kb from sko-mir-4818c
sko-mir-4818cGL015416.1: 65470-65568 [-]
sko-mir-4818aGL015416.1: 65099-65176 [-]
sko-mir-4818dGL015416.1: 64657-64757 [-]
sko-mir-4818gGL015416.1: 64531-64631 [-]
sko-mir-4818bGL015416.1: 64345-64436 [-]
sko-mir-4818eGL015416.1: 63398-63498 [-]
sko-mir-4818fGL015416.1: 63295-63397 [-]
Database links

Mature sequence sko-miR-4818c

Accession MIMAT0020012
Sequence

60 - 

aauugcacuuuacagugguguu

 - 81

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:21210939 "microRNA complements in deuterostomes: origin and evolution of microRNAs" Campo-Paysaa F, Semon M, Cameron RA, Peterson KJ, Schubert M Evol Dev. 13:15-27(2011).