Stem-loop sequence sko-mir-4818e

AccessionMI0017553 (change log)
DescriptionSaccoglossus kowalevskii miR-4818e stem-loop
Gene family MIPF0001211; mir-4818
Stem-loop
   ugcuauauuc     u  cg  a   uu   c          --u    uu 
5'           uaugu ga  ga ccu  cua ugugugcaau   agug  a
             ||||| ||  || |||  ||| ||||||||||   ||||  g
3'           auaca uu  uu ggg  gau acacacguua   uuac  u
   -acuauacca     -  au  c   gu   a          cuc    uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Skow_1.1; GCA_000003605.1) Overlapping transcripts
GL015416.1: 63398-63498 [-]
intergenic
Clustered miRNAs
< 10kb from sko-mir-4818e
sko-mir-4818cGL015416.1: 65470-65568 [-]
sko-mir-4818aGL015416.1: 65099-65176 [-]
sko-mir-4818dGL015416.1: 64657-64757 [-]
sko-mir-4818gGL015416.1: 64531-64631 [-]
sko-mir-4818bGL015416.1: 64345-64436 [-]
sko-mir-4818eGL015416.1: 63398-63498 [-]
sko-mir-4818fGL015416.1: 63295-63397 [-]
Database links

Mature sequence sko-miR-4818e-5p

Accession MIMAT0020014
Previous IDssko-miR-4818e*
Sequence

24 - 

ccuuucuacugugugcaauuag

 - 45

Get sequence
Evidence experimental; 454 [1]

Mature sequence sko-miR-4818e-3p

Accession MIMAT0020015
Previous IDssko-miR-4818e
Sequence

61 - 

cauugcacacaauaguggggc

 - 81

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:21210939 "microRNA complements in deuterostomes: origin and evolution of microRNAs" Campo-Paysaa F, Semon M, Cameron RA, Peterson KJ, Schubert M Evol Dev. 13:15-27(2011).