Stem-loop sequence sko-mir-4818g

AccessionMI0017555 (change log)
DescriptionSaccoglossus kowalevskii miR-4818g stem-loop
Stem-loop
   --a    uuuc     a   u   u           ua   u     ugaug 
5'    augg    uguuu guu gga cuccauuauug  ugc auuag     a
      ||||    ||||| ||| ||| |||||||||||  ||| |||||     u
3'    uacc    auaaa caa ucu ggggugauaac  acg uaauc     a
   ucc    ---c     -   u   u           gc   u     ugguc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Skow_1.1; GCA_000003605.1) Overlapping transcripts
GL015416.1: 64531-64631 [-]
intergenic
Clustered miRNAs
< 10kb from sko-mir-4818g
sko-mir-4818cGL015416.1: 65470-65568 [-]
sko-mir-4818aGL015416.1: 65099-65176 [-]
sko-mir-4818dGL015416.1: 64657-64757 [-]
sko-mir-4818gGL015416.1: 64531-64631 [-]
sko-mir-4818bGL015416.1: 64345-64436 [-]
sko-mir-4818eGL015416.1: 63398-63498 [-]
sko-mir-4818fGL015416.1: 63295-63397 [-]
Database links

Mature sequence sko-miR-4818g-5p

Accession MIMAT0020017
Previous IDssko-miR-4818g*
Sequence

25 - 

uccauuauuguaugcuauuagu

 - 46

Get sequence
Evidence experimental; 454 [1]

Mature sequence sko-miR-4818g-3p

Accession MIMAT0020018
Previous IDssko-miR-4818g
Sequence

61 - 

aauugcacgcaauagugggguu

 - 82

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:21210939 "microRNA complements in deuterostomes: origin and evolution of microRNAs" Campo-Paysaa F, Semon M, Cameron RA, Peterson KJ, Schubert M Evol Dev. 13:15-27(2011).