Stem-loop sequence bfl-mir-4857

AccessionMI0017610 (change log)
DescriptionBranchiostoma floridae miR-4857 stem-loop
Gene family MIPF0001842; mir-4857
Stem-loop
   c   -    -ac        u     cu      --    g 
5'  cgu gguc   gauguuuu gucug  ccagag  guga u
    ||| ||||   |||||||| |||||  ||||||  ||||  
3'  gca ccag   cuacaaag cagac  gguuuc  cauu u
   -   a    acu        -     ag      ag    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2; GCF_000003815.1) Overlapping transcripts
GG666534.1: 217921-217998 [+]
intergenic
Clustered miRNAs
< 10kb from bfl-mir-4857
bfl-mir-4869GG666534.1: 216744-216826 [+]
bfl-mir-4857GG666534.1: 217921-217998 [+]
bfl-mir-4862GG666534.1: 218827-218894 [+]
bfl-mir-4856bGG666534.1: 219709-219795 [+]
bfl-mir-4856aGG666534.1: 220264-220351 [+]
Database links

Mature sequence bfl-miR-4857

Accession MIMAT0020083
Sequence

9 - 

acgauguuuuugucugcuccaga

 - 31

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:21210939 "microRNA complements in deuterostomes: origin and evolution of microRNAs" Campo-Paysaa F, Semon M, Cameron RA, Peterson KJ, Schubert M Evol Dev. 13:15-27(2011).