Stem-loop sequence xbo-mir-92a

AccessionMI0017684 (change log)
DescriptionXenoturbella bocki miR-92a stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
     -   g           a  u  -    c     ---      
5' cg gug uuugucgggcc gg cg gugc auguu   cuguu 
   || ||| ||||||||||| || || |||| |||||   |||| a
3' gc cac aaacaguccgg cc gc cacg uauaa   gauag 
     a   a           c  u  u    u     ugu      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence xbo-miR-92a

Accession MIMAT0020118
Sequence

50 - 

uauugcacucgucccggccugac

 - 72

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:21307940 "Acoelomorph flatworms are deuterostomes related to Xenoturbella" Philippe H, Brinkmann H, Copley RR, Moroz LL, Nakano H, Poustka AJ, Wallberg A, Peterson KJ, Telford MJ Nature. 470:255-258(2011).