Stem-loop sequence cel-mir-4938

AccessionMI0017724 (change log)
DescriptionCaenorhabditis elegans miR-4938 stem-loop
Stem-loop
   ---------uc   --a    --ugccaca      u  u   gc     cag  u   gc 
5'            cgu   uugc         uugaca ca cau  aucau   ca gcu  g
              |||   ||||         |||||| || |||  |||||   || |||   
3'            gca   aacg         aacugu gu gua  uagua   gu cga  c
   aaauuuaauaa   gcc    uuauuauaa      u  u   aa     -aa  c   ga 
Get sequence
Deep sequencing
32 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIII: 5785117-5785226 [+]
antisense
Y37B11A.3 ; Y37B11A.3; 5'UTR (exon 1)
Database links

Mature sequence cel-miR-4938

Accession MIMAT0020144
Sequence

23 - 

aucaucaugcaucaucagcaugc

 - 45

Get sequence
Deep sequencing28 reads, 3 experiments
Evidence experimental; 454 [1]

References

1
PMID:21129974 "MicroRNAs both promote and antagonize longevity in C. elegans" de Lencastre A, Pincus Z, Zhou K, Kato M, Lee SS, Slack FJ Curr Biol. 20:2159-2168(2010).