Stem-loop sequence dme-mir-4942

AccessionMI0017728 (change log)
DescriptionDrosophila melanogaster miR-4942 stem-loop
Stem-loop
   uaugaauac       -uu    -------     -       u   -   gc       u 
5'          auauauu   uaug       uuuga gucaaca cga guu  cgauguu g
            |||||||   ||||       ||||| ||||||| ||| |||  ||||||| g
3'          uauauaa   auac       aagcu cgguugu gcu cag  gcuacaa a
   -----uuga       ucu    cuguaua     a       c   a   ua       a 
Get sequence
Deep sequencing
23 reads, 0 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3L: 23339228-23339337 [+]
sense
FBtr0331408 ; CG32230-RC; 3'UTR (exon 1)
FBtr0070040 ; CG32230-RA; 3'UTR (exon 1)
FBtr0070041 ; CG32230-RB; 3'UTR (exon 1)
Database links

Mature sequence dme-miR-4942-3p

Accession MIMAT0020150
Sequence

60 - 

ucgaugacaucgcuguuggcau

 - 81

Get sequence
Deep sequencing21 reads, 15 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:21177969 "Deep annotation of Drosophila melanogaster microRNAs yields insights into their processing, modification, and emergence" Berezikov E, Robine N, Samsonova A, Westholm JO, Naqvi A, Hung JH, Okamura K, Dai Q, Bortolamiol-Becet D, Martin R, Zhao Y, Zamore PD, Hannon GJ, Marra MA, Weng Z, Perrimon N, Lai EC Genome Res. 21:203-215(2011).