Stem-loop sequence dme-mir-4962

AccessionMI0017748 (change log)
DescriptionDrosophila melanogaster miR-4962 stem-loop
Stem-loop
   ------uccuuucuu    cuc  u           c      - uguuuacauugagcuguuuu 
5'                uucu   cg cucucucuuuc cucucu c                    g
                  ||||   || ||||||||||| |||||| |                     
3'                aaga   gc gagagagggag gagaga g                    u
   guguuacucgacaau    uaa  -           u      u uagcagaucgugcacgugcc 
Get sequence
Deep sequencing
111 reads, 0 reads per million, 27 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chrX: 3777382-3777505 [+]
sense
FBtr0299579 ; tlk-RE; intron 1
FBtr0333751 ; tlk-RK; intron 1
FBtr0333753 ; tlk-RM; intron 1
FBtr0299583 ; tlk-RI; intron 1
FBtr0299580 ; tlk-RF; intron 2
FBtr0299582 ; tlk-RH; intron 2
FBtr0301659 ; tlk-RJ; intron 2
FBtr0333752 ; tlk-RL; intron 2
FBtr0299581 ; tlk-RG; intron 2
FBtr0112680 ; tlk-RB; intron 3
Database links

Mature sequence dme-miR-4962-5p

Accession MIMAT0020183
Sequence

27 - 

uuucccucucucuguuuacauuga

 - 50

Get sequence
Deep sequencing10 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence dme-miR-4962-3p

Accession MIMAT0020184
Sequence

75 - 

gacgauguagagagugagggaga

 - 97

Get sequence
Deep sequencing93 reads, 23 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21177969 "Deep annotation of Drosophila melanogaster microRNAs yields insights into their processing, modification, and emergence" Berezikov E, Robine N, Samsonova A, Westholm JO, Naqvi A, Hung JH, Okamura K, Dai Q, Bortolamiol-Becet D, Martin R, Zhao Y, Zamore PD, Hannon GJ, Marra MA, Weng Z, Perrimon N, Lai EC Genome Res. 21:203-215(2011).