Stem-loop sequence dme-mir-4965

AccessionMI0017751 (change log)
DescriptionDrosophila melanogaster miR-4965 stem-loop
Stem-loop
   cacaa     ucga    a  -    c cc  a      -   ga 
5'      gguga    uggg ga ugag g  ug ugugau gau  a
        |||||    |||| || |||| |  || |||||| |||  g
3'      cuacu    accc cu acuc c  ac acacua cua  u
   ----c     uugg    a  c    a ac  c      g   ga 
Get sequence
Deep sequencing
13 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chrX: 16606108-16606194 [+]
sense
FBtr0299587 ; Nup153-RC; intron 5
FBtr0074284 ; Nup153-RA; intron 6
FBtr0113475 ; Nup153-RB; intron 6
Database links

Mature sequence dme-miR-4965-5p

Accession MIMAT0020188
Sequence

18 - 

gagaugagcgccugaugugau

 - 38

Get sequence
Deep sequencing7 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence dme-miR-4965-3p

Accession MIMAT0020189
Sequence

54 - 

ucacaccacacacucacucacc

 - 75

Get sequence
Deep sequencing4 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21177969 "Deep annotation of Drosophila melanogaster microRNAs yields insights into their processing, modification, and emergence" Berezikov E, Robine N, Samsonova A, Westholm JO, Naqvi A, Hung JH, Okamura K, Dai Q, Bortolamiol-Becet D, Martin R, Zhao Y, Zamore PD, Hannon GJ, Marra MA, Weng Z, Perrimon N, Lai EC Genome Res. 21:203-215(2011).