Stem-loop sequence dme-mir-4973

AccessionMI0017759 (change log)
DescriptionDrosophila melanogaster miR-4973 stem-loop
Stem-loop
   cucguuca     c  -  c           g  cu   cuacugagcuccguuuggacugcuccuccuccaacuac 
5'         gucgu gu ug guguuguaggu gc  ggu                                      u
           ||||| || || ||||||||||| ||  |||                                       
3'         cggca ca ac cacaacgucca cg  ccg                                      a
   ---gacaa     c  c  u           a  -u   ccuacgucgucggcgucgucgucgucgucgccggcguc 
Get sequence
Deep sequencing
92 reads, 0 reads per million, 28 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2L: 20562298-20562448 [+]
intergenic
Database links

Mature sequence dme-miR-4973-5p

Accession MIMAT0020201
Sequence

8 - 

agucgucguugcguguuguag

 - 28

Get sequence
Deep sequencing16 reads, 12 experiments
Evidence experimental; Illumina [1]

Mature sequence dme-miR-4973-3p

Accession MIMAT0020202
Sequence

127 - 

ugcaacacucacaccacggcaa

 - 148

Get sequence
Deep sequencing16 reads, 6 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:21177969 "Deep annotation of Drosophila melanogaster microRNAs yields insights into their processing, modification, and emergence" Berezikov E, Robine N, Samsonova A, Westholm JO, Naqvi A, Hung JH, Okamura K, Dai Q, Bortolamiol-Becet D, Martin R, Zhao Y, Zamore PD, Hannon GJ, Marra MA, Weng Z, Perrimon N, Lai EC Genome Res. 21:203-215(2011).