Stem-loop sequence dme-mir-4982

AccessionMI0017768 (change log)
DescriptionDrosophila melanogaster miR-4982 stem-loop
Literature search

1 open access papers mention dme-mir-4982
(1 sentences)

Stem-loop
   ---   a   -u  u    uu       c   ----            ug   uu     uguug 
5'    cca cuu  gc ggca  cgguggc aau    aaugcaauugca  ucc  guugc     c
      ||| |||  || ||||  ||||||| |||    ||||||||||||  |||  |||||      
3'    ggu gag  cg ucgu  gucgccg uug    uuacguuaacgu  agg  cgacg     a
   aac   -   cu  -    -c       -   aucu            ua   -u     uugua 
Get sequence
Deep sequencing
40 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 18720169-18720287 [+]
sense
FBtr0086608 ; Hs3st-A-RA; intron 2
Database links

Mature sequence dme-miR-4982-5p

Accession MIMAT0020215
Sequence

30 - 

augcaauugcauguccuuguu

 - 50

Get sequence
Deep sequencing25 reads, 8 experiments
Evidence experimental; Illumina [1]

Mature sequence dme-miR-4982-3p

Accession MIMAT0020216
Sequence

67 - 

agcuggaauugcaauugcauuu

 - 88

Get sequence
Deep sequencing7 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21177969 "Deep annotation of Drosophila melanogaster microRNAs yields insights into their processing, modification, and emergence" Berezikov E, Robine N, Samsonova A, Westholm JO, Naqvi A, Hung JH, Okamura K, Dai Q, Bortolamiol-Becet D, Martin R, Zhao Y, Zamore PD, Hannon GJ, Marra MA, Weng Z, Perrimon N, Lai EC Genome Res. 21:203-215(2011).