Stem-loop sequence ssp-MIR827

AccessionMI0018181 (change log)
DescriptionSaccharum sp. miR827 stem-loop
Gene family MIPF0000726; MIR827
Stem-loop
   -  c     u                      uuccaucgaugggugcaugguuuauggcagagu 
5'  ac uguuu guugguggucauuuaaccaugc                                 g
    || ||||| ||||||||||||||||||||||                                  
3'  ug acaaa cgacuaccaguagauugguacg                                 u
   u  u     -                      uguguacguacugguacuacucaaguaccguag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssp-miR827

Accession MIMAT0020279
Sequence

106 - 

uuagaugaccaucagcaaaca

 - 126

Get sequence
Evidence not experimental

References

1
PMID:21092324 "Identification and expression analysis of microRNAs and targets in the biofuel crop sugarcane" Zanca AS, Vicentini R, Ortiz-Morea FA, Del Bem LE, da Silva MJ, Vincentz M, Nogueira FT BMC Plant Biol. 10:260(2010).