Stem-loop sequence bfl-mir-4891

AccessionMI0017663 (change log)
DescriptionBranchiostoma floridae miR-4891 stem-loop
Gene family MIPF0001856; mir-4891
Stem-loop
   --     ----       a        u      c   a    c  g 
5'   uggcu    guuuggg agaugagc guucug uac gcug uu u
     |||||    ||||||| |||||||| |||||| ||| |||| ||  
3'   accgg    caaaccc ucugcucg caggac aug cgau ag c
   uc     ucua       g        -      a   -    c  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2; GCF_000003815.1) Overlapping transcripts
GG666611.1: 901456-901543 [-]
intergenic
Database links

Mature sequence bfl-miR-4891-5p

Accession MIMAT0020480
Sequence

13 - 

aagaugagcuguucugcuacagcu

 - 36

Get sequence
Evidence experimental; 454 [1]

Mature sequence bfl-miR-4891-3p

Accession MIMAT0020481
Sequence

50 - 

gcguaacaggacgcucgucugc

 - 71

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:21210939 "microRNA complements in deuterostomes: origin and evolution of microRNAs" Campo-Paysaa F, Semon M, Cameron RA, Peterson KJ, Schubert M Evol Dev. 13:15-27(2011).