Stem-loop sequence dme-mir-4910

AccessionMI0017692 (change log)
DescriptionDrosophila melanogaster miR-4910 stem-loop
Stem-loop
   ---guuu        uu    -   c  ca   u 
5'        guauggaa  ccau gag uu  aag a
          ||||||||  |||| ||| ||  ||| a
3'        uauacuuu  ggug cuc aa  uuc u
   gacccuu        uu    u   -  uc   g 
Get sequence
Deep sequencing
29 reads, 0 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2L: 4817816-4817881 [-]
sense
FBtr0077416 ; CG3225-RA; intron 2
Database links

Mature sequence dme-miR-4910-5p

Accession MIMAT0020503
Sequence

1 - 

guuuguauggaauuccaugag

 - 21

Get sequence
Deep sequencing26 reads, 13 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:21177960 "Computational and experimental identification of mirtrons in Drosophila melanogaster and Caenorhabditis elegans" Chung WJ, Agius P, Westholm JO, Chen M, Okamura K, Robine N, Leslie CS, Lai EC Genome Res. 21:286-300(2011).