Stem-loop sequence dme-mir-4909

AccessionMI0017704 (change log)
DescriptionDrosophila melanogaster miR-4909 stem-loop
Stem-loop
   g    u    -           c        
5'  uagg ugaa aucggauacaa uaaaagu 
    |||| |||| ||||||||||| |||||| u
3'  auuu acuu uggccuauguu auuuuua 
   g    u    c           a        
Get sequence
Deep sequencing
162 reads, 0 reads per million, 21 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 7711417-7711476 [+]
sense
FBtr0088927 ; CG1941-RA; intron 5
Database links

Mature sequence dme-miR-4909-3p

Accession MIMAT0020515
Sequence

38 - 

auuguauccggucuucauuuuag

 - 60

Get sequence
Deep sequencing154 reads, 20 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21177960 "Computational and experimental identification of mirtrons in Drosophila melanogaster and Caenorhabditis elegans" Chung WJ, Agius P, Westholm JO, Chen M, Okamura K, Robine N, Leslie CS, Lai EC Genome Res. 21:286-300(2011).