Stem-loop sequence ath-MIR5024

AccessionMI0017894 (change log)
DescriptionArabidopsis thaliana miR5024 stem-loop
Stem-loop
      u     acc  a                                aa   a                             uauugaag 
5' gga auuga   ga gaucgacgguugagaugacaaggccaagauau  caa aagauauuauucuagaagauaaauguuaa        u
   ||| |||||   || ||||||||||||||||||||||||||||||||  ||| |||||||||||||||||||||||||||||         
3' ucu uagcu   cu cuaguugccaacuuuacuguuccgguucuaug  guu uuuuauaauaagauuuucuauuuacaauu        u
      c     -gu  -                                cc   c                             ugaaagau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 16766259-16766438 [-]
intergenic
Database links

Mature sequence ath-miR5024-5p

Accession MIMAT0020530
Previous IDsath-miR5024
Sequence

30 - 

augacaaggccaagauauaaca

 - 51

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence ath-miR5024-3p

Accession MIMAT0021048
Sequence

134 - 

ccguaucuuggccuugucauu

 - 154

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21357774 "MicroRNA activity in the Arabidopsis male germline" Borges F, Pereira PA, Slotkin RK, Martienssen RA, Becker JD J Exp Bot. 62:1611-1620(2011).
2
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).